Characterization of Regional Influenza Seasonality Patterns in China and Implications for Vaccination Strategies: Spatio-Temporal Modeling of Surveillance Data

There is no author summary for this article yet. Authors can add summaries to their articles on ScienceOpen to make them more accessible to a non-specialist audience.

Abstract

Cécile Viboud and colleagues describe epidemiological patterns of influenza incidence across China to support the design of a national vaccination program.

Please see later in the article for the Editors' Summary

Abstract

Background

The complexity of influenza seasonal patterns in the inter-tropical zone impedes the establishment of effective routine immunization programs. China is a climatologically and economically diverse country, which has yet to establish a national influenza vaccination program. Here we characterize the diversity of influenza seasonality in China and make recommendations to guide future vaccination programs.

Methods and Findings

We compiled weekly reports of laboratory-confirmed influenza A and B infections from sentinel hospitals in cities representing 30 Chinese provinces, 2005–2011, and data on population demographics, mobility patterns, socio-economic, and climate factors. We applied linear regression models with harmonic terms to estimate influenza seasonal characteristics, including the amplitude of annual and semi-annual periodicities, their ratio, and peak timing. Hierarchical Bayesian modeling and hierarchical clustering were used to identify predictors of influenza seasonal characteristics and define epidemiologically-relevant regions. The annual periodicity of influenza A epidemics increased with latitude (mean amplitude of annual cycle standardized by mean incidence, 140% [95% CI 128%–151%] in the north versus 37% [95% CI 27%–47%] in the south, p<0.0001). Epidemics peaked in January–February in Northern China (latitude ≥33°N) and April–June in southernmost regions (latitude <27°N). Provinces at intermediate latitudes experienced dominant semi-annual influenza A periodicity with peaks in January–February and June–August (periodicity ratio >0.6 in provinces located within 27.4°N–31.3°N, slope of latitudinal gradient with latitude −0.016 [95% CI −0.025 to −0.008], p<0.001). In contrast, influenza B activity predominated in colder months throughout most of China. Climate factors were the strongest predictors of influenza seasonality, including minimum temperature, hours of sunshine, and maximum rainfall. Our main study limitations include a short surveillance period and sparse influenza sampling in some of the southern provinces.

Conclusions

Regional-specific influenza vaccination strategies would be optimal in China; in particular, annual campaigns should be initiated 4–6 months apart in Northern and Southern China. Influenza surveillance should be strengthened in mid-latitude provinces, given the complexity of seasonal patterns in this region. More broadly, our findings are consistent with the role of climatic factors on influenza transmission dynamics.

Please see later in the article for the Editors' Summary

Editors' Summary

Background

Every year, millions of people worldwide catch influenza, a viral disease of the airways. Most infected individuals recover quickly but seasonal influenza outbreaks (epidemics) kill about half a million people annually. These epidemics occur because antigenic drift—frequent small changes in the viral proteins to which the immune system responds—means that an immune response produced one year provides only partial protection against influenza the next year. Annual vaccination with a mixture of killed influenza viruses of the major circulating strains boosts this natural immunity and greatly reduces the risk of catching influenza. Consequently, many countries run seasonal influenza vaccination programs. Because the immune response induced by vaccination decays within 4–8 months of vaccination and because of antigenic drift, it is important that these programs are initiated only a few weeks before the onset of local influenza activity. Thus, vaccination starts in early autumn in temperate zones (regions of the world that have a mild climate, part way between a tropical and a polar climate), because seasonal influenza outbreaks occur in the winter months when low humidity and low temperatures favor the transmission of the influenza virus.

Why Was This Study Done?

Unlike temperate regions, seasonal influenza patterns are very diverse in tropical countries, which lie between latitudes 23.5°N and 23.5°S, and in the subtropical countries slightly north and south of these latitudes. In some of these countries, there is year-round influenza activity, in others influenza epidemics occur annually or semi-annually (twice yearly). This complexity, which is perhaps driven by rainfall fluctuations, complicates the establishment of effective routine immunization programs in tropical and subtropical countries. Take China as an example. Before a national influenza vaccination program can be established in this large, climatologically diverse country, public-health experts need a clear picture of influenza seasonality across the country. Here, the researchers use spatio-temporal modeling of influenza surveillance data to characterize the seasonality of influenza A and B (the two types of influenza that usually cause epidemics) in China, to assess the role of putative drivers of seasonality, and to identify broad epidemiological regions (areas with specific patterns of disease) that could be used as a basis to optimize the timing of future Chinese vaccination programs.

What Did the Researchers Do and Find?

The researchers collected together the weekly reports of laboratory-confirmed influenza prepared by the Chinese national sentinel hospital-based surveillance network between 2005 and 2011, data on population size and density, mobility patterns, and socio-economic factors, and daily meteorological data for the cities participating in the surveillance network. They then used various statistical modeling approaches to estimate influenza seasonal characteristics, to assess predictors of influenza seasonal characteristics, and to identify epidemiologically relevant regions. These analyses indicate that, over the study period, northern provinces (latitudes greater than 33°N) experienced winter epidemics of influenza A in January–February, southern provinces (latitudes less than 27°N) experienced peak viral activity in the spring (April–June), and provinces at intermediate latitudes experienced semi-annual epidemic cycles with infection peaks in January–February and June–August. By contrast, influenza B activity predominated in the colder months throughout China. The researchers also report that minimum temperatures, hours of sunshine, and maximum rainfall were the strongest predictors of influenza seasonality.

What Do These Findings Mean?

These findings show that influenza seasonality in China varies between regions and between influenza virus types and suggest that, as in other settings, some of these variations might be associated with specific climatic factors. The accuracy of these findings is limited by the short surveillance period, by sparse surveillance data from some southern and mid-latitude provinces, and by some aspects of the modeling approach used in the study. Further surveillance studies need to be undertaken to confirm influenza seasonality patterns in China. Overall, these findings suggest that, to optimize routine influenza vaccination in China, it will be necessary to stagger the timing of vaccination over three broad geographical regions. More generally, given that there is growing interest in rolling out national influenza immunization programs in low- and middle-income countries, these findings highlight the importance of ensuring that vaccination strategies are optimized by taking into account local disease patterns.

Additional Information

Please access these websites via the online version of this summary at http://dx.doi.org/ 10.1371/journal.pmed.1001552.

This study is further discussed in a PLOS Medicine Perspective by Steven Riley
The UK National Health Service Choices website provides information for patients about seasonal influenza and about influenza vaccination
The World Health Organization provides information on seasonal influenza (in several languages) and on influenza surveillance and monitoring
The US Centers for Disease Control and Prevention also provides information for patients and health professionals on all aspects of seasonal influenza, including information about vaccination; its website contains a short video about personal experiences of influenza.
Flu.gov, a US government website, provides access to information on seasonal influenza and vaccination
Information about the Chinese National Influenza Center, which is part of the Chinese Center for Disease Control and Prevention: and which runs influenza surveillance in China, is available (in English and Chinese)
MedlinePlus has links to further information about influenza and about vaccination (in English and Spanish)
A recent PLOS Pathogens Research Article by James D. Tamerius et al. investigates environmental predictors of seasonal influenza epidemics across temperate and tropical climates
A study published in PLOS ONE by Wyller Alencar de Mello et al. indicates that Brazil, like China, requires staggered timing of vaccination from Northern to Southern states to account for different timings of influenza activity.

Related collections

Most cited references 35

Record: found
Abstract: found
Article: not found

Influenza Virus Transmission Is Dependent on Relative Humidity and Temperature

Anice C. Lowen, Samira Mubareka, John Steel … (2007)

Introduction Influenza A virus, of the family Orthomyxoviridae, carries an RNA genome consisting of eight segments of negative-stranded RNA. This genome encodes one or two non-structural proteins and nine structural proteins, which, together with a host cell–derived lipid envelope, comprise the influenza virus particle. Influenza virus causes widespread morbidity and mortality among human populations worldwide: in the United States alone, an average of 41,400 deaths and 1.68 million hospitalizations [1] are attributed to influenza each year. In temperate regions like the United States, this impact is felt predominantly during the winter months; that is, epidemics recur with a highly predictable seasonal pattern. In northern latitudes, influenza viruses circulate from November to March, while in the southern hemisphere influenza occurs primarily from May to September [2]. Tropical regions, by contrast, experience influenza throughout the year, although increased incidence has been correlated with rainy seasons [2,3]. Despite extensive documentation of the seasonal cycles of influenza and curiosity as to their causes, little concrete data is available to indicate why influenza virus infections peak in the wintertime. Theories to explain the seasonal variation of influenza have therefore proliferated over the years (reviewed in [4]). Current hypotheses include fluctuations in host immune competence mediated by seasonal factors such as melatonin [5] and vitamin D [6] levels; seasonal changes in host behavior, such as school attendance, air travel [7], and indoor crowding during cold or rainy weather; and environmental factors, including temperature [8], relative humidity (RH), and the direction of air movement in the upper atmosphere [9]. In early studies using mouse-adapted strains of influenza virus, experiments performed in the winter months yielded a transmission rate of 58.2%; in contrast, a rate of only 34.1% was observed in the summer months [10]. While these data suggested that the seasonal influences acting on humans also affect laboratory mice, no mechanism to explain the observations was identified. Herein, we directly tested the hypotheses that ambient air temperature and RH impact the efficiency with which influenza virus is spread. As a mammalian animal model we used Hartley strain guinea pigs, which we have recently shown to be highly susceptible to infection with human influenza viruses [11]. Importantly, we also found that naïve guinea pigs readily become infected when exposed to inoculated guinea pigs, unlike mice, which do not efficiently transmit influenza virus [11]. Thus, by housing infected and naïve guinea pigs together in an environmental chamber, we were able to assess the efficiency of transmission under conditions of controlled RH and temperature. Our data show that both RH and temperature do indeed affect the frequency of influenza virus transmission among guinea pigs, although via apparently differing mechanisms. Results Twenty replicate experiments were performed in which all factors remained constant except for the RH and/or temperature inside the environmental chamber. Each experiment involved eight guinea pigs, and transmission under each set of conditions was assessed in duplicate. The arrangement of animals in the environmental chamber is illustrated in Figure 1. Virus contained in nasal wash samples collected on alternating days post-inoculation (p.i.) was titrated by plaque assay to determine the infection status of each animal. Serum samples were collected from each animal prior to infection and on day 17 p.i., and seroconversion was assessed by hemagglutination inhibition assay (results in Table S1). Figure 1 Arrangement of Infected and Exposed Guinea Pigs in Environmental Chamber In each experiment, eight animals were housed in a Caron 6030 environmental chamber. Each guinea pig was placed in its own cage, and two cages were positioned on each shelf. Naïve animals were placed behind infected animals, such that the direction of airflow was toward the naïve animals. The cages used were open to airflow through the top and one side, both of which were covered by wire mesh. Although infected and exposed guinea pigs were placed in pairs, air flowed freely between shelves, allowing transmission to occur from any infected to any naïve animal. In general, the behavior (level of activity, food and water consumption, symptoms of infection) of guinea pigs was not observed to change with the ambient relative humidity. Likewise, animals housed at 5 °C behaved in a similar manner to those housed at 20 °C. Guinea pigs kept at 30 °C consumed more water than those housed under cooler conditions, and appeared lethargic. Consistent with our previous observations [11], influenza virus–infected guinea pigs did not display detectable symptoms of disease (e.g., weight loss, fever, sneezing, coughing) during the experiments described. Transmission Efficiency Is Dependent on Relative Humidity The results of transmission experiments performed at 20 °C and five different RHs (20%, 35%, 50%, 65%, and 80%) indicated that the efficiency of aerosol spread of influenza virus varied with RH. Transmission was highly efficient (occurred to three or four of four exposed guinea pigs) at low RH values of 20% or 35%. At an intermediate RH of 50%, however, only one of four naïve animals contracted infection. Three of four exposed guinea pigs were infected at 65% RH, while no transmission was observed at a high RH of 80% (Figure 2). Where transmission was observed, the kinetics with which infection was detected in each exposed animal varied between and within experiments. To an extent, we believe this variation is due to the stochastic nature of infection. However, while most infection events were the product of primary transmission from an inoculated animal, others could be the result of secondary transmission from a previously infected, exposed guinea pig. With the exception of the lack of transmission at 80% RH, the observed relationship between transmission and RH is similar to that between influenza virus stability in an aerosol and RH [12], suggesting that at 20 °C the sensitivity of transmission to humidity is due largely to virus stability. Figure 2 Transmission of Influenza Virus from Guinea Pig to Guinea Pig Is Dependent on Relative Humidity Titers of influenza virus in nasal wash samples are plotted as a function of day p.i. Overall transmission rate and the RH and temperature conditions of each experiment are stated underneath the graph. Titers from intranasally inoculated guinea pigs are represented as dashed lines; titers from exposed guinea pigs are shown with solid lines. Virus titrations were performed by plaque assay on Madin Darby canine kidney cells. Transmission Efficiency Is Inversely Correlated with Temperature To test whether cold temperatures would increase transmission, the ambient temperature in the chamber was lowered to 5 °C and experiments were performed at 35%–80% RH. Overall, transmission was more efficient at 5 °C: 75%–100% transmission occurred at 35% and 50% RH, and 50% transmission was observed at 65% and 80% RH (Figure 3A–3H). The statistical significance of differences in transmission rates at 5 °C compared to 20 °C was assessed using the Fisher's exact test. While at 35% and 65% RH the difference was not found to be significant, at both 50% and 80% RH, transmissibility at 5 °C was found to be greater than that at 20 °C (p 20 °C) and either intermediate (50%) or high (80%) RHs. Materials and Methods Virus. Influenza A/Panama/2007/99 virus (Pan/99; H3N2) was kindly supplied by Adolfo García-Sastre and was propagated in Madin Darby canine kidney cells. Animals. Female Hartley strain guinea pigs weighing 300–350 g were obtained from Charles River Laboratories. Animals were allowed free access to food and water and kept on a 12-h light/dark cycle. Guinea pigs were anesthetized for the collection of blood and of nasal wash samples, using a mixture of ketamine (30 mg/kg) and xylazine (2 mg/kg), administered intramuscularly. All procedures were performed in accordance with the Institutional Animal Care and Used Committee guidelines. During guinea pig transmission experiments, strict measures were followed to prevent aberrant cross-contamination between cages: sentinel animals were handled before inoculated animals, gloves were changed between cages, and work surfaces were sanitized between guinea pigs. Transmission experiments. The term “aerosol” is used herein to describe respiratory droplets of all sizes. The term “droplet nuclei” is used to refer to droplets that remain airborne (typically less than 5 μm in diameter). Each transmission experiment involved eight guinea pigs. On day 0, four of the eight guinea pigs were inoculated intranasally with 103 PFU of influenza A/Panama/2007/99 virus (150 μl per nostril in phosphate buffered saline [PBS] supplemented with 0.3% bovine serum albumin [BSA]) and housed in a separate room from the remaining animals. At 24 h p.i., each of the eight guinea pigs was placed in a “transmission cage”, a standard rat cage (Ancare R20 series) with an open wire top, which has been modified by replacing one side panel with a wire grid. The transmission cages were then placed into the environmental chamber (Caron model 6030) with two cages per shelf, such that the wire grids opposed each other (Figure 1). In this arrangement, the guinea pigs cannot come into physical contact with each other. Each infected animal was paired on a shelf with a naïve animal. The guinea pigs were housed in this way for 7 d, after which they were removed from the chamber and separated. On day 2 p.i. (day 1 post-exposure) and every second day thereafter up to day 12 p.i., nasal wash samples were collected from anesthetized guinea pigs by instilling 1 ml of PBS-BSA into the nostrils and collecting the wash in a Petri dish. Titers in nasal wash samples were determined by plaque assay of 10-fold serial dilutions on Madin Darby canine kidney cells. Serum samples were collected from each animal prior to infection and on day 17 post-infection, and seroconversion was assessed by hemagglutination inhibition assay. All transmission experiments reported herein were performed between September 2006 and April 2007. Analysis of expression levels of mediators of innate immunity. Guinea pigs were inoculated with 103 PFU of Pan/99 virus intranasally and immediately housed under the appropriate conditions (5 °C or 20 °C and 35% RH). At days 1, 2, 3, 5, and 7 post-infection, three guinea pigs were killed and their nasal turbinates removed. Tissues were placed immediately in RNAlater reagent (Qiagen), and stored at 4 °C for 1 to 5 d. RNA was extracted from equivalent masses of tissue using the RNAeasy Protect Mini kit (Qiagen) and subjected to DNAse treatment (Qiagen). One microgram of RNA was subjected to reverse transcription using MMLV reverse transcriptase (Roche). One microlitre of the resultant product was used as the template in a SYBR green (Invitrogen) real-time PCR assay (Roche Light Cycler 480) with Ampli-taq Gold polymerase (Perkin-Elmer). Primers used were as follows: β-actin f AAACTGGAACGGTGAAGGTG; β-actin r CTTCCTCTGTGGAGGAGTGG; Mx1 f CATCCCYTTGrTCATCCAGT; Mx1 r CATCCCyTTGRTCATCCAGT; MDA-5 f GAGCCAGAGCTGATGARAGC; MDA-5 r TCTTATGWGCATACTCCTCTGG; IL-1β f GAAGAAGAGCCCATCGTCTG; IL-1β r CATGGGTCAGACAACACCAG; RANTES f GCAATGCTAGCAGCTTCTCC; RANTES r TTGCCTTGAAAGATGTGCTG; TLR3 f TAACCACGCACTCTGTTTGC; TLR3 r ACAGTATTGCGGGATCCAAG; TNFα f TTCCGGGCAGATCTACTTTG; TNFα r TGAACCAGGAGAAGGTGAGG; MCP-1 f ATTGCCAAACTGGACCAGAG; MCP-1 r CTACGGTTCTTGGGGTCTTG; MCP-3 f TCATTGCAGTCCTTCTGTGC; MCP-3 r TAGTCTCTGCACCCGAATCC; IFNγ f GACCTGAGCAAGACCCTGAG; IFNγ r TGGCTCAGAATGCAGAGATG; STAT1 f AAGGGGCCATCACATTCAC; STAT1 r GCTTCCTTTGGCCTGGAG; TBK1 f CAAGAAACTyTGCCwCAGAAA; TBK1 r AGGCCACCATCCAykGTTA; IRF5 f CAAACCCCGaGAGAAGAAG; IRF5 r CTGCTGGGACtGCCAGA; IRF7 f TGCAAGGTGTACTGGGAGGT; IRF7 r TCACCAGGATCAGGGTCTTC (where R = A or G, Y = C or T, W = A or T, K = T or G). Primer sequences were based either on guinea pig mRNA sequences available in GenBank (MCP1, MCP3, IL-1b, IFNγ, RANTES, TLR3, TNFα, and β-actin), or on the consensus sequence of all species available in GenBank (Mx1, MDA-5, IRF5, IRF7, STAT1, and TBK1). Sequencing of each PCR product indicated that all primer pairs were specific for the expected transcript. Reactions were performed in duplicate and normalized by dividing the mean value of the cycle threshold (Ct) of β-actin expressed as an exponent of 2 (2Ct) by the mean value of 2Ct for the target gene. The fold-induction over the mock-infected was then calculated by dividing the normalized value by the normalized mock value. Data is represented in Figure 5 as the mean of three like samples (nasal turbinates harvested on the same day p.i. from three guinea pigs) ± standard deviation. Statistical analyses. Statistical analyses were performed using GraphPad Prism 5 software. Supporting Information Table S1 Seroconversion of Inoculated and Exposed Guinea Pigs Results of hemagglutination inhibition tests for each transmission experiment are shown. (58 KB DOC) Click here for additional data file. Accession Numbers The GenBank (http://www.ncbi.nlm.nih.gov/Genbank/index.html) accession numbers of guinea pig genes used for primer design are as follows: β-actin (AF508792.1); IFNγ (AY151287.1); IL-1β (AF119622); MCP-1 (L04985); MCP-3 (AB014340); RANTES (CPU77037); TLR3 (DQ415679.1); and TNFα (CPU77036).

0 comments Cited 631 times – based on 0 reviews      Review now

Bookmark

Record: found
Abstract: found
Article: not found

Hospitalizations associated with influenza and respiratory syncytial virus in the United States, 1993-2008.

Hong Xing Zhou, William W Thompson, Cecile G. Viboud … (2012)

Age-specific comparisons of influenza and respiratory syncytial virus (RSV) hospitalization rates can inform prevention efforts, including vaccine development plans. Previous US studies have not estimated jointly the burden of these viruses using similar data sources and over many seasons. We estimated influenza and RSV hospitalizations in 5 age categories (<1, 1-4, 5-49, 50-64, and ≥65 years) with data for 13 states from 1993-1994 through 2007-2008. For each state and age group, we estimated the contribution of influenza and RSV to hospitalizations for respiratory and circulatory disease by using negative binomial regression models that incorporated weekly influenza and RSV surveillance data as covariates. Mean rates of influenza and RSV hospitalizations were 63.5 (95% confidence interval [CI], 37.5-237) and 55.3 (95% CI, 44.4-107) per 100000 person-years, respectively. The highest hospitalization rates for influenza were among persons aged ≥65 years (309/100000; 95% CI, 186-1100) and those aged <1 year (151/100000; 95% CI, 151-660). For RSV, children aged <1 year had the highest hospitalization rate (2350/100000; 95% CI, 2220-2520) followed by those aged 1-4 years (178/100000; 95% CI, 155-230). Age-standardized annual rates per 100000 person-years varied substantially for influenza (33-100) but less for RSV (42-77). Overall US hospitalization rates for influenza and RSV are similar; however, their age-specific burdens differ dramatically. Our estimates are consistent with those from previous studies focusing either on influenza or RSV. Our approach provides robust national comparisons of hospitalizations associated with these 2 viral respiratory pathogens by age group and over time.

0 comments Cited 258 times – based on 0 reviews      Review now

Bookmark

Record: found
Abstract: found
Article: found

Is Open Access

Global Influenza Seasonality: Reconciling Patterns across Temperate and Tropical Regions

James D. Tamerius, Martha Nelson, Steven Zhou … (2010)

Background Despite the significant disease burden of the influenza virus in humans, our understanding of the basis for its pronounced seasonality remains incomplete. Past observations that influenza epidemics occur in the winter across temperate climates, combined with insufficient knowledge about the epidemiology of influenza in the tropics, led to the perception that cool and dry conditions were a necessary, and possibly sufficient, driver of influenza epidemics. Recent reports of substantial levels of influenza virus activity and well-defined seasonality in tropical regions, where warm and humid conditions often persist year-round, have rendered previous hypotheses insufficient for explaining global patterns of influenza. Objective In this review, we examined the scientific evidence for the seasonal mechanisms that potentially explain the complex seasonal patterns of influenza disease activity observed globally. Methods In this review we assessed the strength of a range of hypotheses that attempt to explain observations of influenza seasonality across different latitudes and how they relate to each other. We reviewed studies describing population-scale observations, mathematical models, and ecological, laboratory, and clinical experiments pertaining to influenza seasonality. The literature review includes studies that directly mention the topic of influenza seasonality, as well as other topics we believed to be relevant. We also developed an analytical framework that highlights the complex interactions among environmental stimuli, mediating mechanisms, and the seasonal timing of influenza epidemics and identify critical areas for further research. Conclusions The central questions in influenza seasonality remain unresolved. Future research is particularly needed in tropical localities, where our understanding of seasonality remains poor, and will require a combination of experimental and observational studies. Further understanding of the environmental factors that drive influenza circulation also may be useful to predict how dynamics will be affected at regional levels by global climate change.

0 comments Cited 214 times – based on 0 reviews      Review now

Bookmark

All references

Author and article information

Contributors

Steven Riley: Role: Academic Editor

Journal

Journal ID (nlm-ta): PLoS Med

Journal ID (iso-abbrev): PLoS Med

Journal ID (publisher-id): PLoS

Journal ID (pmc): plosmed

Title: PLoS Medicine

Publisher: Public Library of Science (San Francisco, USA )

ISSN (Print): 1549-1277

ISSN (Electronic): 1549-1676

Publication date Collection: November 2013

Publication date (Print): November 2013

Publication date (Electronic): 19 November 2013

Volume: 10

Issue: 11

Electronic Location Identifier: e1001552

Affiliations

[1 ]Division of Infectious Disease, Key Laboratory of Surveillance and Early-warning on Infectious Disease, Chinese Centre for Disease Control and Prevention, Beijing, China

[2 ]Fogarty International Center, National Institutes of Health, Bethesda, Maryland, United States of America

[3 ]National Institute for Viral Disease Control and Prevention, China CDC, Key Laboratory for Medical Virology, National Health and Family Planning Commission, Beijing, China

Imperial College London, United Kingdom

Author notes

* E-mail: viboudc@ 123456mail.nih.gov (CV); yangwz@ 123456chinacdc.cn (WY)

The authors have declared that no competing interests exist.

Conceived and designed the experiments: HY WA CV. Performed the experiments: WA CV. Analyzed the data: LF YT WA CV. Contributed reagents/materials/analysis tools: YS WY. Wrote the first draft of the manuscript: CV. Contributed to the writing of the manuscript: HY WA YT LF YS WY CV. ICMJE criteria for authorship read and met: HY WA YT LF YS WY CV. Agree with manuscript results and conclusions: HY WA YT LF YS WY CV.

Article

Publisher ID: PMEDICINE-D-13-00364

DOI: 10.1371/journal.pmed.1001552

PMC ID: 3864611

PubMed ID: 24348203

SO-VID: eb7dcd4f-f368-49a8-9f23-8d19103599b7

License:

This is an open-access article, free of all copyright, and may be freely reproduced, distributed, transmitted, modified, built upon, or otherwise used by anyone for any lawful purpose. The work is made available under the Creative Commons CC0 public domain dedication.

History

Date received : 4 February 2013

Date accepted : 10 October 2013

Page count

Pages: 16

Funding

This work was supported by the US National Institutes of Health (Comprehensive International Program for Research on AIDS grant U19 AI51915); the China-U.S. Collaborative Program on Emerging and Re-emerging Infectious Diseases; grants from the Ministry of Science and Technology, China (2012 ZX10004-201); and the in-house Influenza Research Program of the Division of International Epidemiology and Population Studies, Fogarty International Center, National Institutes of Health, which is funded by the Pandemic Emergent Threats Unit, Office of Global Affairs, Department of Health and Human Services. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Characterization of Regional Influenza Seasonality Patterns in China and Implications for Vaccination Strategies: Spatio-Temporal Modeling of Surveillance Data

Read this article at

Abstract

Abstract

Background

Methods and Findings

Conclusions

Editors' Summary

Background

Why Was This Study Done?

What Did the Researchers Do and Find?

What Do These Findings Mean?

Additional Information

Related collections

China Occupational Medicine

Most cited references 35

Influenza Virus Transmission Is Dependent on Relative Humidity and Temperature

Hospitalizations associated with influenza and respiratory syncytial virus in the United States, 1993-2008.

Global Influenza Seasonality: Reconciling Patterns across Temperate and Tropical Regions

Author and article information

Contributors

Journal

Affiliations

Author notes

Article

History

Page count

Funding

Categories

Comments

Comment on this article

Similar content 5

Cited by 134

Most referenced authors 546